stata ic software version 15 1 Search Results


99
STATA Corporation stata mp v 15 1
Stata Mp V 15 1, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/STATA+15%2E0/pm39791523-56-16-19
Average 99 stars, based on 1 article reviews
stata mp v 15 1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

96
New England Biolabs 151 bp pcr fragment
151 Bp Pcr Fragment, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/PCR+Marker/pmc12284203-94-9-22
Average 96 stars, based on 1 article reviews
151 bp pcr fragment - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

96
New England Biolabs 151 base pair bp pcr
151 Base Pair Bp Pcr, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/HaeIII/pm17046213-91-2-14
Average 96 stars, based on 1 article reviews
151 base pair bp pcr - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
STATA Corporation version 11 1
Version 11 1, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/STATA+11%2E0/pm27387724-69-8-10
Average 99 stars, based on 1 article reviews
version 11 1 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
STATA Corporation analyses 151
Analyses 151, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/STATA+14%2E0/ppr0058081-68-2-10
Average 99 stars, based on 1 article reviews
analyses 151 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
STATA Corporation stata 15 1 se version
Stata 15 1 Se Version, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/STATA+1%2E0/pmc12752081-84-6-6
Average 99 stars, based on 1 article reviews
stata 15 1 se version - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs mir 425 seed sequence aguugcccucacuag cacagua a site mutation kit
The online software Targetscan (version 7.2) was firstly used to predict the microRNA which could regulate the expression of TGF-β1. Therefore, <t>miR-425</t> was acquired from the predict result. The complementary region sequence in TGF-β 1 3′ UTR was GGACUGCGGAUCUCUGUGUCAUU, which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAGCACAGUAA.
Mir 425 Seed Sequence Aguugcccucacuag Cacagua A Site Mutation Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/Q5+Site-Directed+Mutagenesis+Kit/bio_rxiv__477877-90-19-30
Average 99 stars, based on 1 article reviews
mir 425 seed sequence aguugcccucacuag cacagua a site mutation kit - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

98
New England Biolabs nebnext enzymatic methyl seq kit
The online software Targetscan (version 7.2) was firstly used to predict the microRNA which could regulate the expression of TGF-β1. Therefore, <t>miR-425</t> was acquired from the predict result. The complementary region sequence in TGF-β 1 3′ UTR was GGACUGCGGAUCUCUGUGUCAUU, which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAGCACAGUAA.
Nebnext Enzymatic Methyl Seq Kit, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/NEBNext+Enzymatic+Methyl-seq+Kit/pm34588447-533-10-14
Average 98 stars, based on 1 article reviews
nebnext enzymatic methyl seq kit - by Bioz Stars, 2026-09
98/100 stars
  Buy from Supplier

96
Illumina Inc truseq dna methylation kit
Phenotyping and global levels of <t>DNA</t> <t>methylation</t> in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.
Truseq Dna Methylation Kit, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/TruSeq-Methyl+Capture+EPIC+Library+Prep+Kit/pmc08222998-101-5-9
Average 96 stars, based on 1 article reviews
truseq dna methylation kit - by Bioz Stars, 2026-09
96/100 stars
  Buy from Supplier

99
STATA Corporation mp 6
Phenotyping and global levels of <t>DNA</t> <t>methylation</t> in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.
Mp 6, supplied by STATA Corporation, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/STATA+6%2E0/pmc09396388-4-25-24
Average 99 stars, based on 1 article reviews
mp 6 - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs thermoscript reverse transcriptase
Phenotyping and global levels of <t>DNA</t> <t>methylation</t> in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.
Thermoscript Reverse Transcriptase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/Exonuclease+I/10__1128_slash_jvi__02570___14-88-32-45
Average 99 stars, based on 1 article reviews
thermoscript reverse transcriptase - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

99
New England Biolabs rs2071746t a snp
Phenotyping and global levels of <t>DNA</t> <t>methylation</t> in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.
Rs2071746t A Snp, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/stata+ic+software+version+15+1/HindIII/pmc12623185-106-5-14
Average 99 stars, based on 1 article reviews
rs2071746t a snp - by Bioz Stars, 2026-09
99/100 stars
  Buy from Supplier

Image Search Results


The online software Targetscan (version 7.2) was firstly used to predict the microRNA which could regulate the expression of TGF-β1. Therefore, miR-425 was acquired from the predict result. The complementary region sequence in TGF-β 1 3′ UTR was GGACUGCGGAUCUCUGUGUCAUU, which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAGCACAGUAA.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: The online software Targetscan (version 7.2) was firstly used to predict the microRNA which could regulate the expression of TGF-β1. Therefore, miR-425 was acquired from the predict result. The complementary region sequence in TGF-β 1 3′ UTR was GGACUGCGGAUCUCUGUGUCAUU, which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAGCACAGUAA.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Software, Expressing, Sequencing

The relative miR-425 expression levels in non-tumor, para-tumor, and tumor tissues (n=60) were determined using qRT-PCR method. This result identified the relative miR-425 expression level in tumor tissues was obviously less than that of non-tumor or para-tumor tissues ( P < 0.001). However, there was no obvious difference between para-tumor and non-tumor tissues. *** P <0.001.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: The relative miR-425 expression levels in non-tumor, para-tumor, and tumor tissues (n=60) were determined using qRT-PCR method. This result identified the relative miR-425 expression level in tumor tissues was obviously less than that of non-tumor or para-tumor tissues ( P < 0.001). However, there was no obvious difference between para-tumor and non-tumor tissues. *** P <0.001.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Expressing, Quantitative RT-PCR

The relative miR-425 expression levels were investigated in six cell lines of human TNBC. Compared with basal epithelial phenotype cell line Hs 578T, the relative miR-425 expression levels were significantly higher in mesenchymal phenotypic cell line MDA-MB-231 ( P < 0.001). The data are presented as means ± SD from at least three independent experiments. *** P <0.001.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: The relative miR-425 expression levels were investigated in six cell lines of human TNBC. Compared with basal epithelial phenotype cell line Hs 578T, the relative miR-425 expression levels were significantly higher in mesenchymal phenotypic cell line MDA-MB-231 ( P < 0.001). The data are presented as means ± SD from at least three independent experiments. *** P <0.001.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Expressing

The target of miR-425 were predicted with Targetscan, the online software. Therefore, miR-425 was found that possibly aimed to 3’ UTRs untranslated region of TGF-β1 mRNA. Further experiments were conducted using luciferase reporter gene system to identify whether miR-425 could straight bind with 3’ UTRs of TGF-β1 mRNA. The data indicated 3’ UTR luciferase activities of TGF-β1 significantly down-regulated in MDA-MB-231 cell line dealt with miR-425 ( A ). However, it did not show obviously change in the group of TGF-β1 mutation ( B ). Moreover, miR-425 did not bind straight to 3’ UTRs of E-cadherin ( C ), VE-cadherin ( D ), N-cadherin ( E ), Vimentin ( F ), α-SMA ( G ), and SMAD3 ( H ), respectively. These data identified that miR-425 targeted to TGF-β1 mRNAs. The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: The target of miR-425 were predicted with Targetscan, the online software. Therefore, miR-425 was found that possibly aimed to 3’ UTRs untranslated region of TGF-β1 mRNA. Further experiments were conducted using luciferase reporter gene system to identify whether miR-425 could straight bind with 3’ UTRs of TGF-β1 mRNA. The data indicated 3’ UTR luciferase activities of TGF-β1 significantly down-regulated in MDA-MB-231 cell line dealt with miR-425 ( A ). However, it did not show obviously change in the group of TGF-β1 mutation ( B ). Moreover, miR-425 did not bind straight to 3’ UTRs of E-cadherin ( C ), VE-cadherin ( D ), N-cadherin ( E ), Vimentin ( F ), α-SMA ( G ), and SMAD3 ( H ), respectively. These data identified that miR-425 targeted to TGF-β1 mRNAs. The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Software, Luciferase, Mutagenesis

To explore the roles of miR-425 on mRNAs and proteins expression of TGF-β1, E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) in human BC cell lines, the qRT-PCR assay and western blotting trial were performed. These results demonstrated miR-425 restrained TGF-β1 mRNAs and proteins expressions in MDA-MB-231 cell line. However, miR-425 could not suppress the expression of E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, and SMAD3 mRNAs ( A ), but promote proteins expression of E-cadherin and VE-cadherin, while suppress proteins expression of N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) ( C ). Moreover, miR-425 inhibitors could promote expression of TGF-β1 mRNA in MDA-MB-231, but did not affect mRNAs expression of E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) ( A ). The inhibitors of miR-425 could suppress the protein expression levels of N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3), but promote protein expression of E-cadherin and VE-cadherin ( C ). In a word, by binding with TGF-β1 3′-UTR, the result indicated miR-425 could straight regulate its mRNA and protein expression, further affect protein expression of genes associated with EndMT process and TGF-β1/SMAD3 pathway. It was same as the results in other cell line Hs 578T ( B and D ). The mesenchymal markers expression of N-cadherin, Vimentin, α-SMA, SMAD3 and p-SMAD3 in TNBC cell lines were inhibited significantly, while endothelial markers expression of E-cadherin and VE-cadherin were obviously promoted by mimics of miR-425 in vitro compared with control group ( C and D ). But, the expression of mesenchymal cell markers in TNBC cell lines were significantly promoted, while endothelial markers expression of E-cadherin and VE-cadherin were significantly suppressed by mimics of miR-425 in TNBC cell lines ( C and D ). The ratio of phosphorylated versus total protein did not show significant difference between each groups in MDA-MB-231 and Hs 578T cell lines ( E and F ). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: To explore the roles of miR-425 on mRNAs and proteins expression of TGF-β1, E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) in human BC cell lines, the qRT-PCR assay and western blotting trial were performed. These results demonstrated miR-425 restrained TGF-β1 mRNAs and proteins expressions in MDA-MB-231 cell line. However, miR-425 could not suppress the expression of E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, and SMAD3 mRNAs ( A ), but promote proteins expression of E-cadherin and VE-cadherin, while suppress proteins expression of N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) ( C ). Moreover, miR-425 inhibitors could promote expression of TGF-β1 mRNA in MDA-MB-231, but did not affect mRNAs expression of E-cadherin, VE-cadherin, N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3) ( A ). The inhibitors of miR-425 could suppress the protein expression levels of N-cadherin, Vimentin, α-SMA, total and phosphorylated SMAD3 (p-SMAD3), but promote protein expression of E-cadherin and VE-cadherin ( C ). In a word, by binding with TGF-β1 3′-UTR, the result indicated miR-425 could straight regulate its mRNA and protein expression, further affect protein expression of genes associated with EndMT process and TGF-β1/SMAD3 pathway. It was same as the results in other cell line Hs 578T ( B and D ). The mesenchymal markers expression of N-cadherin, Vimentin, α-SMA, SMAD3 and p-SMAD3 in TNBC cell lines were inhibited significantly, while endothelial markers expression of E-cadherin and VE-cadherin were obviously promoted by mimics of miR-425 in vitro compared with control group ( C and D ). But, the expression of mesenchymal cell markers in TNBC cell lines were significantly promoted, while endothelial markers expression of E-cadherin and VE-cadherin were significantly suppressed by mimics of miR-425 in TNBC cell lines ( C and D ). The ratio of phosphorylated versus total protein did not show significant difference between each groups in MDA-MB-231 and Hs 578T cell lines ( E and F ). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Expressing, Quantitative RT-PCR, Western Blot, Binding Assay, In Vitro

To assess the biofunctions of miR-425, over-expressed and down-expressed miR-425 was conducted, respectively. Furthermore, several molecular functional tests were performed in TNBC cell lines. The proliferation ability of TNBC cell lines was suppressed by miR-425 compared to that of control. Moreover, the change of proliferation ability induced by mimics of miR-425 in mesenchymal phenotypic cell line MDA-MB-231 was significantly more than that of basal epithelial phenotype cell line Hs 578T, while the difference was statistically significant ( P <0.05). Additionally, the inhibitors of miR-425 promoted proliferation ability of TNBC cell lines. Furthermore, the change of proliferation ability induced by inhibitors of miR-425 in mesenchymal phenotypic cell line MDA-MB-231 was higher than that of basal epithelial phenotype cell line Hs 578T, while the difference between the two type cell lines was not statistically significant ( P >0.05). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: To assess the biofunctions of miR-425, over-expressed and down-expressed miR-425 was conducted, respectively. Furthermore, several molecular functional tests were performed in TNBC cell lines. The proliferation ability of TNBC cell lines was suppressed by miR-425 compared to that of control. Moreover, the change of proliferation ability induced by mimics of miR-425 in mesenchymal phenotypic cell line MDA-MB-231 was significantly more than that of basal epithelial phenotype cell line Hs 578T, while the difference was statistically significant ( P <0.05). Additionally, the inhibitors of miR-425 promoted proliferation ability of TNBC cell lines. Furthermore, the change of proliferation ability induced by inhibitors of miR-425 in mesenchymal phenotypic cell line MDA-MB-231 was higher than that of basal epithelial phenotype cell line Hs 578T, while the difference between the two type cell lines was not statistically significant ( P >0.05). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Functional Assay

Moreover, the inhibitors of miR-425 promoted invasion ability of TNBC cell lines, but the mimics of miR-425 suppressed the invasion ability of TNBC cell lines.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: Moreover, the inhibitors of miR-425 promoted invasion ability of TNBC cell lines, but the mimics of miR-425 suppressed the invasion ability of TNBC cell lines.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques:

To detect anti-tumor activity induced by miR-425 agomir in vivo , human TNBC xenografts were established with MDA-MB-231 cells. Our work demonstrated that the size of tumor ( A ) and the average tumor weight ( B ) of control mice was much larger than that of experiment mice treated with agomir of miR-425, and the difference between two groups had statistical significance. Moreover, the xenografts of control groups grew rapidly, but in the experiment group, which was treated with agomir of miR-425, grew slowly in vivo ( C ). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: To detect anti-tumor activity induced by miR-425 agomir in vivo , human TNBC xenografts were established with MDA-MB-231 cells. Our work demonstrated that the size of tumor ( A ) and the average tumor weight ( B ) of control mice was much larger than that of experiment mice treated with agomir of miR-425, and the difference between two groups had statistical significance. Moreover, the xenografts of control groups grew rapidly, but in the experiment group, which was treated with agomir of miR-425, grew slowly in vivo ( C ). The data are presented as means ± SD from three independent experiments. * P <0.05, ** P <0.01.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Activity Assay, In Vivo

The expression proteins in xenografts were determined with immunohistochemical staining ( A ) and western blotting methods ( B) , respectively. As we can see, the results revealed that when compare with control group (from left to right, control 1-3), treatment with agomir of miR-425 (from left to right, experiment 1-3) could down-regulate the expression of TGF-β1 and SMAD3 with a statistically significant, and suppressed mesenchymal markers expression of xenograft. The mesenchymal markers expression of N-cadherin, Vimentin, α-SMA, SMAD3, p-SMAD3 and endothelial markers E-cadherin, VE-cadherinin in xenografts were determined.

Journal: bioRxiv

Article Title: miR-425 suppresses EMT and inhibits the development of TNBC (triple-negative breast cancer) by targeting TGF-β 1/SMAD 3 signaling pathway

doi: 10.1101/477877

Figure Lengend Snippet: The expression proteins in xenografts were determined with immunohistochemical staining ( A ) and western blotting methods ( B) , respectively. As we can see, the results revealed that when compare with control group (from left to right, control 1-3), treatment with agomir of miR-425 (from left to right, experiment 1-3) could down-regulate the expression of TGF-β1 and SMAD3 with a statistically significant, and suppressed mesenchymal markers expression of xenograft. The mesenchymal markers expression of N-cadherin, Vimentin, α-SMA, SMAD3, p-SMAD3 and endothelial markers E-cadherin, VE-cadherinin in xenografts were determined.

Article Snippet: The complementary region sequence in TGF-β1 3′UTR was GGACUGCGGAUCUCU GUGUCAU U , which located at position 151-157, and corresponding miR-425 seed sequence AGUUGCCCUCACUAG CACAGUA A. Site-Mutation kit (Cat. no. E0554S; New England Biolabs Ltd, UK) was used to constructed TGF-β1 3′UTR mutated vector.

Techniques: Expressing, Immunohistochemical staining, Staining, Western Blot

Phenotyping and global levels of DNA methylation in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.

Journal: Frontiers in Plant Science

Article Title: Identification of DNA Methylation and Transcriptomic Profiles Associated With Fruit Mealiness in Prunus persica (L.) Batsch

doi: 10.3389/fpls.2021.684130

Figure Lengend Snippet: Phenotyping and global levels of DNA methylation in P. persica fruits susceptible and resistant to mealiness. (A) Experimental design for one resistant and one susceptible individual for mealiness. At harvest (E1), three fruits per tree were used for MethylC-Seq and RNA-Seq analysis, while another pool of fruits was stored in a cold chamber at 0 °C to promote mealiness. After 30 days of cold treatment (E3 stage), three fruits were used for MethylC-Seq and RNA-Seq analysis. At E4 stage, at least five fruits were ripened at room temperature and used for the measure of juice content. (B) Juice content (%) during four seasons in at least five fruits of an individual resistant and susceptible to mealiness, respectively. The dotted line represents a 30% threshold to consider fruits as mealy or normal. The same trees were evaluated in all seasons. (C) Absolute methylation levels (%) for cytosine contexts CpG, CHG and CHH (H = C, T or A) in normal and mealy fruits at E1 and E3.

Article Snippet: Libraries were generated with the TruSeq DNA Methylation kit (Illumina, San Diego, CA, United States) according to manufacturer’s instructions.

Techniques: DNA Methylation Assay, RNA Sequencing, Methylation

DNA methylation levels across the eight pseudomolecules of P. Persica. (A) Methylation levels considering all cytosine contexts in normal fruits (blue line) and mealy fruits (green line). Horizontal green bars represent the location of previously identified QTLs for mealiness, while dashed vertical lines indicates the approximate location of centromeres. (B) Methylation levels in CpG, CHG, and CHH contexts within chromosome 4, the main candidate associated with mealiness phenotype based on QTL studies.

Journal: Frontiers in Plant Science

Article Title: Identification of DNA Methylation and Transcriptomic Profiles Associated With Fruit Mealiness in Prunus persica (L.) Batsch

doi: 10.3389/fpls.2021.684130

Figure Lengend Snippet: DNA methylation levels across the eight pseudomolecules of P. Persica. (A) Methylation levels considering all cytosine contexts in normal fruits (blue line) and mealy fruits (green line). Horizontal green bars represent the location of previously identified QTLs for mealiness, while dashed vertical lines indicates the approximate location of centromeres. (B) Methylation levels in CpG, CHG, and CHH contexts within chromosome 4, the main candidate associated with mealiness phenotype based on QTL studies.

Article Snippet: Libraries were generated with the TruSeq DNA Methylation kit (Illumina, San Diego, CA, United States) according to manufacturer’s instructions.

Techniques: DNA Methylation Assay, Methylation

Average distribution of global DNA methylation throughout coding regions and number of differentially methylated regions. (A) DNA methylation level in annotated genes, including 2 kb upstream and downstream of the transcription start site (TSS) and transcription end site (TES), respectively. Each color represents a different condition. (B) DNA methylation level in annotated transposable elements (TE), including 2 kb upstream and downstream of TSS and TES. (C) Number of Differentially Methylated Regions (DMRs) close to annotated genes (up to 2 kb upstream and downstream) in normal fruits at E3 vs. E1 stages, mealy fruits at E3 vs. E1, mealy fruits vs. normal fruits at E1 and mealy fruits vs. normal fruits at E3. Blue bars indicate hypermethylated regions and red bars hypomethylated regions. DMRs where considered in all cytosine contexts and individual contexts (CpG, CHG, and CHH). Three biological replicates, a log2 enrichment difference >1 and a p -value < 0.05 were considered to identify a DMR.

Journal: Frontiers in Plant Science

Article Title: Identification of DNA Methylation and Transcriptomic Profiles Associated With Fruit Mealiness in Prunus persica (L.) Batsch

doi: 10.3389/fpls.2021.684130

Figure Lengend Snippet: Average distribution of global DNA methylation throughout coding regions and number of differentially methylated regions. (A) DNA methylation level in annotated genes, including 2 kb upstream and downstream of the transcription start site (TSS) and transcription end site (TES), respectively. Each color represents a different condition. (B) DNA methylation level in annotated transposable elements (TE), including 2 kb upstream and downstream of TSS and TES. (C) Number of Differentially Methylated Regions (DMRs) close to annotated genes (up to 2 kb upstream and downstream) in normal fruits at E3 vs. E1 stages, mealy fruits at E3 vs. E1, mealy fruits vs. normal fruits at E1 and mealy fruits vs. normal fruits at E3. Blue bars indicate hypermethylated regions and red bars hypomethylated regions. DMRs where considered in all cytosine contexts and individual contexts (CpG, CHG, and CHH). Three biological replicates, a log2 enrichment difference >1 and a p -value < 0.05 were considered to identify a DMR.

Article Snippet: Libraries were generated with the TruSeq DNA Methylation kit (Illumina, San Diego, CA, United States) according to manufacturer’s instructions.

Techniques: DNA Methylation Assay, Methylation

Differentially expressed genes between normal and mealy fruits associated with changes in DNA methylation. (A) Expression levels of DEGs overlapping with DMRs between normal and mealy fruits at E1. DEGs are grouped as hypermethylated and hypomethylated. (B) Cytosine methylation level of a hypermethylated region in mealy fruits compared to normal fruits. The DMR of approximately 2.500 bp is located within the coding region of a CYP450 82A3 (Prupe.3G066200) gene. Color key indicates methylation levels where green represents high levels and red, low levels. (C) Expression levels of DEGs overlapping with hypermethylated regions between normal and mealy fruits at E3. (D) DNA methylation level of a hypermethylated region in mealy fruits compared to normal fruits. The DMR of approximately 120 bp is located in the promoter region of an UDP-ARABINOSE 4-EPIMERASE1 (Prupe.3G187800) gene.

Journal: Frontiers in Plant Science

Article Title: Identification of DNA Methylation and Transcriptomic Profiles Associated With Fruit Mealiness in Prunus persica (L.) Batsch

doi: 10.3389/fpls.2021.684130

Figure Lengend Snippet: Differentially expressed genes between normal and mealy fruits associated with changes in DNA methylation. (A) Expression levels of DEGs overlapping with DMRs between normal and mealy fruits at E1. DEGs are grouped as hypermethylated and hypomethylated. (B) Cytosine methylation level of a hypermethylated region in mealy fruits compared to normal fruits. The DMR of approximately 2.500 bp is located within the coding region of a CYP450 82A3 (Prupe.3G066200) gene. Color key indicates methylation levels where green represents high levels and red, low levels. (C) Expression levels of DEGs overlapping with hypermethylated regions between normal and mealy fruits at E3. (D) DNA methylation level of a hypermethylated region in mealy fruits compared to normal fruits. The DMR of approximately 120 bp is located in the promoter region of an UDP-ARABINOSE 4-EPIMERASE1 (Prupe.3G187800) gene.

Article Snippet: Libraries were generated with the TruSeq DNA Methylation kit (Illumina, San Diego, CA, United States) according to manufacturer’s instructions.

Techniques: DNA Methylation Assay, Expressing, Methylation